701291548 701291548

18-08-2021
Mathematics

contestada

three decreased by the product of a number and two

Respuesta :

thacrew624 thacrew624

18-08-2021

3-2x should be the right answer

Answer Link

Otras preguntas

Megan has 45.12 in her purse she spends 7.89 on lunch the 21.25 how much money does Megan have left

Today, it risk management is a low-key activity focused on delivering projects and keeping applications up and running.a. Trueb. False

A strand of mRNA has the following sequence: CGCAUAUGCGUAUGCGUAAUAUAUGUUUUCCAAAAUAACAGCAGUAA

Move to Concierge Model. Given the direction of healthcare, what would you recommend if you were Michael? Options: A) Increase the complexity of healthcare pro

With a population of butterflies, the color brown (B) is dominant over the color white (b). And, 40% of all butterflies are white. What is the dominant allele f

The length of a rectangular park is four timesfour times its width. The park is surrounded by a 5-foot-wide path. Let x denote the width of the park. Write a qu

5. Andy drove 840 miles in 12 hours. Based on his speed, how far could ne drive in 3 hours?

Derive expressions for the means and variances of the following linear combinations in terms of the means and covariances of the random variables X₁, X₂ , and X

Out of the nine Principles of Medical Ethics listed, which four do you think are most essential? Explain why you chose those four. Use full sentences in your re

Parties not in ________ usually do not have rights to a contract. a. privileged contract b. acknowledged contract c. privity of contract d. close contract e. di