4804378780 4804378780

18-02-2021
Biology

contestada

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Respuesta :

malakmohammed0101 malakmohammed0101

18-02-2021

CUGCUACAUCGUAGCUGGUAAC

Answer Link

Otras preguntas

What is the Rapture and will it happen?

Temperature is _____ to the average kinetic energy of a gas. a. directly proportional b. inversely proportional c. equal d. not related

Can a mathematician assist? Please explain how (2*10^-3)^3 = 8e^-9 I understand how the exponent is -9 but how does the 2 become an 8

Viet drives around and checks meters to document the amount of electricity used in homes. What Energy pathway is he a part of? Energy Conversion Energy Tran

A medium is a tool? A. Used to convey ideas or information B. That measures important technology C. Used to evaluate information D. That you buy at the hard

Will give Brainliest! if right!

x+3y=15 and 4x+2y=30

How much compound interest will an account of $10,000 bear after 5 years at 3% APR, compounded annually? (Hint: Use the formula for annual compound interest.)

Jase manufacturing co.'s static budget at 10,000 units of production includes $40,000 for direct labor and $4,000 for electric power. total fixed costs are $24,

Which scene from "shooting an elephant" is most likely a metaphor for the ineffectiveness of imperialism??