viaulettac viaulettac

17-04-2020
Mathematics

contestada

Find the length of AP in
the diagram below,
rounding to the nearest tenth

Find the length of AP inthe diagram belowrounding to the nearest tenth class=

Respuesta :

PollyP52 PollyP52

17-04-2020

Answer:

6.9 to the nearest tenth.

Step-by-step explanation:

Use the external tangent - chord theorem:

AP^2 = CP * BP

AP^2 = 12 * 4 = 48

AP = √48

= 6.928

Answer Link

Otras preguntas

Which characteristics of Nazi Germany’s government were those of a totalitarian state? Check all that apply. They discouraged ideas that didn’t benefit the stat

Philip wants to enclose his garden using 30 meters of fence. What is the largest interger value area, in square meteres, that he can enclose? What are the dimen

Magnesium has two valence electrons and oxygen has six valence electrons. The electronegativity difference between the two elements is 2.13. How can the octet r

How did the New Deal change the role of the federal government in the United States?

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Rates Lin, Diego, and Elena are competing to see who can finish their book the fastest. Lin read the first 54 pages from a 270-page book in the first 3 days. Di

Describe the difference between gross motor skills and fine motor skills. Provide an example of each.

Individuals who feel good two to three days a week could not get diagnosed with dysthymia. Group of answer choices True False

How did the US Constitution solve a problem created by the articles of confederation

i tried adding the other 2 but it doesn’t let me - On Tuesday, i clean my bedroom and mop the floor On Wednesday i walk the dogs and lawn the grass